cross kingdom similarity of transcriptional regulation in
play

Platzhalter fr Bild, Bild auf Titelfolie hinter das Logo einsetzen Cross-Kingdom Similarity of Transcriptional Regulation in Innate Immunity Reinhard Hehl, Konstantin Kanofsky, Annika Mller, Alexander Sandmann Institute of Genetics, TU

0 downloads 0 Views 5,95 MB Size Report
  1. Platzhalter für Bild, Bild auf Titelfolie hinter das Logo einsetzen Cross-Kingdom Similarity of Transcriptional Regulation in Innate Immunity Reinhard Hehl, Konstantin Kanofsky, Annika Möller, Alexander Sandmann Institute of Genetics, TU Braunschweig

  2. From the Greening of the TRANSFAC Database............

  3. ............to a Rich Harvest

  4. ............ and to our own Databases like AthaMap Steffens et al., (2004) Nucleic Acids Res. 32: D368-372. Hehl et al., (2016) Plant Cell Physiol 57: e4

  5. ............and PathoPlant Bülow et al., (2004) In Silico Biol. 4: 529–536 Bolívar et al., (2014) Database (Oxford) 2014: bau030

  6. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity Bent and Mackey (2007) Annu Rev Phytopathol 45: 399-436

  7. Novel Cis -Regulatory Sequences for Synthetic Pathogen-Responsive Promoters Lehmeyer et al. (2016) Plant Biotechnology Journal 14: 61-71

  8. Application of Synthetic Pathogen-Responsive Promoters Bent and Mackey (2007) Annu Rev Phytopathol 45: 399-436

  9. Application of Synthetic Pathogen-Responsive Promoters Dietmar Stahl, KWS SAAT AG, modified

  10. Application of Synthetic Pathogen-Responsive Promoters (Helicase of TMV) Agrobacterium tumefaciens (N) Dietmar Stahl, KWS SAAT AG, modified

  11. Application of Synthetic Pathogen-Responsive Promoters Niemeyer et al., (2014) Plant Mol Biol 84: 111-123

  12. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity Hehl and Bülow (2008) Current Genomics 9: 375-380

  13. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity Koschmann et al., (2012) Plant Physiol 160: 178-191

  14. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity 3. Step Motif classification using STAMP 37 motif groups identified Koschmann et al., (2012) Plant Physiol 160: 178-191

  15. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity Spe I Xba I 4 x cis -sequences TATA uid A Koschmann et al., (2012) Plant Physiol 160: 178-191

  16. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity Koschmann et al., (2012) Plant Physiol 160: 178-191

  17. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity WT-box Type Binding TF CGACTTTT I WRKY70 TGACTTTT I WRKY70 GGACTTTT II ? GGACTTTG II ? GGACTTTC II ? Kanofsky et al., (2017) Plant Cell Rep. 36: 971-986 Lehmeyer et al., (2016) Plant Biotechnol J 14: 61–71 Machens et al., (2014) Plant Mol Biol 84: 371-385

  18. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity WRKY70 CRM1 WRKY26 mut2 mut5 W-box WT-box W-box Kanofsky et al., (2017) Plant Cell Rep. 36: 971-986

  19. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity WRKY26 W-box WT-box W-box Kanofsky et al., (2017) Plant Cell Rep. 36: 971-986

  20. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity WT-box Type Binding TF CGACTTTT I WRKY70 TGACTTTT I WRKY70 GGACTTTT II ? GGACTTTG II ? GGACTTTC II WRKY26 Kanofsky et al., (2017) Plant Cell Rep. 36: 971-986

  21. Bioinformatic Prediction of Type II WT-box Interacting Proteins FootprintDB Contreras-Moreira (2010) Nucleic Acids Res 38: D91-97 Sebastian and Contreras-Moreira (2014) Bioinformatics 30: 258-265

  22. Bioinformatic Prediction of Type II WT-box Interacting Proteins Kanofsky et al., unpublished

  23. Bioinformatic Prediction of Type II WT-box Interacting Proteins Ausubel (2005) Nat Immunol 6: 973-979, modified

  24. Bioinformatic Prediction of Type II WT-box Interacting Proteins 140000 ¡ 120000 ¡ pmol ¡4-­‑MU/min/mg ¡ 100000 ¡ 80000 ¡ 60000 ¡ 40000 ¡ 20000 ¡ 0 ¡ S15 ¡ S15mut1 ¡ S15mut2 ¡ S15mut3 ¡ pORE ¡ p65-­‑pORE ¡ S15 AGGACTTTTCACCAGTTGGACTTTGAAGCCACCAA S15mut1 --AGTCCCC-------------------------- S15mut2 ---------TCTTCACCA----------------- S15mut3 ------------------AGTCCCA---------- Kanofsky et al., unpublished

  25. Bioinformatic Prediction of Type II WT-box Interacting Proteins 120.000 ¡ 100.000 ¡ pmol ¡4-­‑MU/min/mg ¡ 80.000 ¡ 60.000 ¡ 40.000 ¡ 20.000 ¡ 0 ¡ S24 ¡ S24mut8 ¡ S24mut5 ¡ S24mut9 ¡ S24mut4 ¡ pORE ¡ p65-­‑pORE ¡ S24 TGGTCAGCATGTTGGACTTTCCAAATTCATTGACC S24mut8 ------ATGCACC---------------------- S24mut5 -------------AAGTCCCTT------------- S24mut9 ----------------------GGGCCTG------ S24mut4 -----------------------------CCAGTT Kanofsky et al., unpublished

  26. Bioinformatic Prediction of Type II WT-box Interacting Proteins Kanofsky et al., unpublished

  27. Identification of Novel Cis -Regulatory Sequences Involved in Plant Innate Immunity WT-box Type Binding TF CGACTTTT I WRKY70 TGACTTTT I WRKY70 GGACTTTT II NF- ! B p65 GGACTTTG II ? GGACTTTC II WRKY26 NF- ! B p65 Kanofsky et al., (2017) Plant Cell Rep. 36: 971-986 Kanofsky et al., unpublished

  28. Bioinformatic Prediction of Type II WT-box Interacting Proteins ? Ausubel (2005) Nat Immunol 6: 973-979, modified

  29. Edgar‘s Post-Retirement Endeavour in Swakopmund, Namibia Edgar‘s

  30. Thank You Spe I Xba I 4 x cis -sequences TATA uid A

Recommend Documents


the circadian clock transcriptional feedback and the
The Circadian Clock, Transcriptional

The Circadian Clock, Transcriptional Feedback and the Regulation of Gene

linking gene expression patterns and transcriptional
Linking gene expression patterns and

Linking gene expression patterns and transcriptional regulation in Plasmodium

semantic similarity
Semantic Similarity MultiJEDI ERC

SemEval 2014 Task-3 Cross-Level Semantic Similarity MultiJEDI ERC 259234

iden fying the interac ons between rna7binding proteins
Iden%fying*the*interac%ons

Iden%fying*the*interac%ons between*RNA7binding proteins*and*microRNAs ! !

integrative analysis of methylation and transcriptional
Integrative analysis of methylation

Integrative analysis of methylation and transcriptional profiles to predict

cross lingual similarity calculation for plagiarism
Cross-lingual similarity calculation

Cross-lingual similarity calculation for plagiarism detection and more Tools

cross species comparison of go annotations advantages and
Cross-species comparison of GO

Cross-species comparison of GO annotations : advantages and limitations of

an etymological approach to cross language orthographic
An Etymological Approach to

An Etymological Approach to Cross-Language Orthographic Similarity.

building a cross lingual relatedness thesaurus using a
Building a Cross-lingual Relatedness

Building a Cross-lingual Relatedness Thesaurus using a Graph Similarity

ngs sequence analysis for regulation and epigenomics
NGS Sequence Analysis for Regulation

NGS Sequence Analysis for Regulation and Epigenomics Timothy Bailey Winter

rna interference and small rnas
RNA Interference and Small RNAs RNAi

RNA Interference and Small RNAs RNAi is an ancient mechanism. Current work is

type ii topoisomerase type ii topoisomerase challenges
Type II topoisomerase Type II

Type II topoisomerase Type II topoisomerase challenges challenges Claudine

rigid body refinement basics
Rigid body refinement (basics)

Rigid body refinement (basics) D.Svergun, EMBL-Hamburg Shapes from recent

la qualit des donn es et des resultats en analyse prot
La qualit des donnes et des resultats

La qualit des donnes et des resultats en analyse protomique Pierre-Alain

magnetic resonance with single nuclear spin sensitivity
Magnetic Resonance with Single

1 Magnetic Resonance with Single Nuclear-Spin Sensitivity Alex Sushkov 2

diffusion tensor imaging visualization techniques and
Diffusion Tensor Imaging Visualization

Diffusion Tensor Imaging Visualization Techniques and Applications Tim

large scale data is everywhere
Large-scale Data is Everywhere! There

Data Mining: Introduction Lecture Notes for Chapter 1 Introduction to Data

the apache way the apache way nick burch nick burch cto
The Apache Way The Apache Way Nick

The Apache Way The Apache Way Nick Burch Nick Burch CTO, Quanticate CTO,

machine learning joy of data
Machine Learning: Joy of Data Sarath

Machine Learning: Joy of Data Sarath Chandar University of Montreal

the apache way the apache way nick burch nick burch cto
The Apache Way The Apache Way Nick

The Apache Way The Apache Way Nick Burch Nick Burch CTO, Quanticate CTO,

tfclass a classifjcation of transcription factors
TFClass a classifjcation of

TFClass a classifjcation of transcription factors Jrgen Dnitz, Edgar

va video acceleration api
VA (Video Acceleration) API Jonathan

VA (Video Acceleration) API Jonathan Bian 2009 Linux Plumbers Conference