Science Science Webinar Series Webinar Series The Future of qPCR The Future of qPCR Best practices, Standardization, and Best practices, Standardization, and the MIQE Guidelines the MIQE Guidelines 30 September, 2010 30 September, 2010 Brought to you by the Science /AAAS Business Office Participating Experts: Dr. Stephen A. Bustin Barts and the London School of Medicine and Dentistry London, UK Dr. Gregory L. Shipley University of Texas Health Science Center at Houston Houston, TX Manju R. Sethi ThermoFisher Scientific Wilmington, DE Sponsored by:
Why MIQE? Dr. Stephen A. Bustin Barts and The London School of Medicine and Dentistry
Real-time PCR • “Gold standard” • Mature • Simple
Primer design Chemistry RT cDNA synthesis RNA QA Assay validation Sample extraction Data analysis Sample selection and handling Data reporting
Real-time PCR • Simple • Complex • Evolving • Mature • Variable • “Gold standard”
Δ C q =15 (3.2x10 4 -fold) Δ C q =13 (0.8x10 4 -fold) Δ C q =14 (1.6x10 4 -fold) Δ C q =21 (2.1x10 6 -fold) Δ C q =21 (2.1x10 6 -fold) Δ C q =19 (5.2x10 5 -fold) Δ C q =13 (0.8x10 4 -fold) Δ C q =19 (5.2x10 5 -fold)
Key Issues Sample quality • Reverse transcription • Assay validation/optimisation • PCR efficiency • Normalisation • >1 RG • validation •
competitive endogenous RNA (ceRNA)
ACTTCTCCATCTCCTGTGTAATCAA
ACTTCTCCATCTCCTGTGTAATCAA
ACTTCTCCATCTCCTGTGTAATCAA
incorrect ✘ analysis
Key Issues Science (n=17) Science (n=17) Cell (n=15) Cell (n=15) BMC (n=16) BMC (n=16) Sample Quality Sample Quality 0 0 0 0 6 6 RT RT 5 5 1 1 8 8 Assay Assay 0 0 2 2 2 2 Optimisation Optimisation PCR efficiency PCR efficiency 1 1 0 0 6 6 Normalisation Normalisation 0 0 1 1 4 4 >1 RG >1 RG RG validation RG validation 0 0 0 0 6 6
Science Science Webinar Series Webinar Series The Future of qPCR The Future of qPCR Best practices, Standardization, and Best practices, Standardization, and the MIQE Guidelines the MIQE Guidelines 30 September, 2010 30 September, 2010 Brought to you by the Science /AAAS Business Office Participating Experts: Dr. Stephen A. Bustin Queen Mary, University of London London, UK Dr. Gregory L. Shipley University of Texas Health Science Center at Houston Houston, TX Manju R. Sethi ThermoFisher Scientific Wilmington, DE Sponsored by:
MIQE Guidelines- Tips and Tricks Gregory L. Shipley, Ph.D.
Outline 1. What is real-time qPCR? 2. MIQE PCR Target information 3. MIQE Assay Validation - how to
What is Real-Time qPCR? Collecting an increasing fluorescent signal for one or more gene targets in real time during a Polymerase Chain Reaction (PCR) leading to a quantitative value for each target. 1- Hydrolysis probe-based detection - FRET 5’ F Primer R Probe Q 3’ 3’ 5’ R Primer R Q 5’ 3’ 3’ 5’
What is Real-Time qPCR? 2- Dye-based Detection - based on SYBR Green I S S 5’ F Primer S 3’ S S S S 3’ S 5’ R Primer 5’ F Primer S S S S 3’ 3’ S S S S 5’ R Primer
What is Real-Time qPCR? 7-log Std Curve using oligo DNA standard Name Cq Std # 1 12.65 Std # 1 12.58 Std # 2 16.43 Std # 2 16.20 Human PTEN Assay Std # 3 19.68 Error: 0.0803 Std # 3 19.74 Efficiency: 1.978 Std # 4 23.15 Slope: -3.375 YIntercept: 37.53 Std # 4 23.20 Std # 5 26.68 Roche LC480 Instrument Std # 5 26.76 Std # 6 29.69
PCR Target Information
m-fold analysis * m-fold server: http://mfold.bioinfo.rpi.edu/
PCR Target Information Useful Websites: http://www.ncbi.nlm.nih.gov/ http://genome.ucsc.edu/ http://www.embl.de/services/bioinformatics/index.php Accession LOCUS NM_019214 2853 bp ss-RNA linear ROD Number 26-JAN-2010DEFINITION Rattus norvegicus solute carrier family 26, Gene member 4 (Slc26a4) Common - PendrinACCESSION Symbol NM_019214VERSION NM_019214.1 GI:9506964KEYWORDS .SOURCE Rattus norvegicus (Norway rat)
PCR Target Information BLAST search result for rSlc26a4 (Pendrin) PCR amplicon Use BLASTN - more sensitive than MegaBLAST
PCR Target Information rSLC26a4 911(+) CAGTCCCGATTCCTATAG = 1114 in the human sequence 988(-) AATTTGCTTCCAAGTTGG = 1191 in the human sequence 940(+) FAM-ACAATTATCGCCACCGCCA-BHQ1 78 base PCR amplicon length; crosses the exon 7/8 boundary Can determine splice junctions in the rat using the human sequence information plus an alignment
PCR Target Information Final Table Information for Publication rat Slc26A4 assay (syn: Pendrin, PDS, DFNB4) NM_019214 911(+) CAGTCCCGATTCCTATAG 988(-) AATTTGCTTCCAAGTTGG 940(+) FAM-ACAATTATCGCCACCGCCA-BHQ1 78 base PCR amplicon length; crosses the exon 7/8 boundary PCR efficiency = 97%; LOD = 23 copies (or Cq value) No known splice variants; single target by BLAST search No folding issues following m-fold analysis w/in the PCR amplicon
qPCR Assay Validation
(NTC = no-template control) (CI = confidence interval) (LOD = limit of detection)
qPCR Validation Assay Validation- Hydrolysis Probes: 1. Probe-based assays (all) depend upon 3 oligonucleotides working in concert to get a fluorescent signal 2. Greatly increases template specificity 3. A standard curve over a wide range of template concentrations will give assay specifications hIAPP (islet amyloid polypeptide) assay using ssDNA oligo template over 7-logs Cq values from 13 to 33, copy numbers from 1x10 7 to 1x10 1 copies (calculated) = LOD Assay stats: Slope = -3.435; r 2 = 0.999; y-intercept = 38.06 cycles; PCR efficiency (10 -1/slope )-1)*100 = 95.5% Variation at the LOD is not significant Minimum assay QC requirements (QGCL)- PCR efficiency ≥ 93%; LOD <30 copies (PCR)
qPCR Validation Assay Validation- SYBR Green or other primer-based assay: 1. Must show template specificity: asymmetric restriction digest on DNA acrylamide gel or sequencing of PCR product 2. Discriminating among sequences from large sequence-related families can be difficult 3. A melt curve alone is not sufficient to show template specificity but is useful information 4. A standard curve over a wide range of template concentrations will give all remaining information Melt Analyses rCDC42ep1 rTnk2
qPCR Validation SYBR Assay Validation made painless 1- Generate RT-PCR or PCR product (1 st run), monitor with real-time qPCR 2- Depending on the Cq value, dilute PCR product 1/100 up to 1/10,000 in E. coli tRNA at10-100 ng/µl 3- Make a 7-8 log standard curve in 10-fold decrements in carrier E. coli tRNA 4- Run dilutions in duplicate PCRs 5- Collect data as below for assay stats and publication Macaca Collagen 1A1: 7-log 6- Record lowest Cq value for each assay that is still linear with the lower dilutions dilution series macCol1A1 SYBR Assay stats: Slope = -3.312 r 2 = 0.999 y-int = 36.70 cycles PCR efficiency = 100% LOD = 33 cycles Cq variation at LOD - not significant Macaca Collagen 1A1
The Important Folks The Important Folks Ms. Mary Sobieski Ms. Xiaoying Wang Dr. Cliff Stephan Ms. Nancy Shipley
Science Science Webinar Series Webinar Series The Future of qPCR The Future of qPCR Best practices, Standardization, and Best practices, Standardization, and the MIQE Guidelines the MIQE Guidelines 30 September, 2010 30 September, 2010 Brought to you by the Science /AAAS Business Office Participating Experts: Dr. Stephen A. Bustin Queen Mary, University of London London, UK Dr. Gregory L. Shipley University of Texas Health Science Center at Houston Houston, TX Manju R. Sethi ThermoFisher Scientific Wilmington, DE Sponsored by:
Making the MIQE Guidelines work for you: practical applications Manju Sethi, B.Tech, M.S. (ChemE) Senior Product Manager, NanoDrop Products September 30, 2010
assays qPCR MIQE Guidelines Checklist Nucleic Acid QC 44
MIQE Guidelines Checklist – QC of Nucleic Acids 45
Why these QC parameters? • Why is quantity so important? • For absolute quantification, samples must lie within the standard curve • For relative quantification, large differences in template quantity increase the potential error in calculated expression ratio, low quantities increase error • In methods using relative quantification for genotyping, signal strength in unknown samples should be similar to that for standards • Why is purity so important? • Residual chemical contamination from extraction procedures can drastically influence downstream analysis • Why is integrity so important? • Reliable results depend on establishment of threshold criteria for RNA quality 46
Recommend
More recommend
