outline
play

Outline Part 1 Introduction to Genomics Part 2 Visual Design for - PowerPoint PPT Presentation

Visual Analytics for Genomics Cydney Nielsen ! BC Cancer Agency ! Vancouver, BC, Canada ! Outline Part 1 Introduction to Genomics Part 2 Visual Design for Genomics Part 3 Hands-On Design Exercise Part 1 Introduction to Genomics Genomics


  1. Visual Analytics for Genomics Cydney Nielsen ! BC Cancer Agency ! Vancouver, BC, Canada !

  2. Outline Part 1 Introduction to Genomics Part 2 Visual Design for Genomics Part 3 Hands-On Design Exercise

  3. Part 1 Introduction to Genomics

  4. Genomics Workflow genome : the complete genetic material of a cell Part 1. Intro to Genomics

  5. Sequencing Experiment Part 1. Intro to Genomics

  6. Sequencing Experiment Part 1. Intro to Genomics

  7. Sequencing Experiment G - C ! T - A ! Part 1. Intro to Genomics

  8. Genomics Workflow sample data insight Part 1. Intro to Genomics

  9. Genomics Workflow sample experiment sequencing technology ! data insight Part 1. Intro to Genomics

  10. Genomics Workflow sample experiment sequencing technology ! data + analysis visualization ! computation ! insight Part 1. Intro to Genomics

  11. Genomics Workflow sample experiment sequencing technology ! data + analysis visualization ! computation ! insight Part 1. Intro to Genomics

  12. Genomics Workflow sample experiment sequencing technology ! data molecular biology Part 1. Intro to Genomics

  13. Genomics Workflow computational biology / bioinformatics visual analytics data + analysis visualization ! computation ! insight Part 1. Intro to Genomics

  14. Genomics Workflow sample experiment sequencing technology ! data molecular biology Part 1. Intro to Genomics

  15. Sequencing Experiment TACACCGATACACCAGA$ ACCAGATGGATTAGATGTA$ AAAAAAAAAAAAAAGATGT$ AAAGATGTATACCACCAG$ CACCAGTACACCGATA$ Sequencing machine ! Millions of short sequences (“reads”) ! e.g. 75 nt each compared to >3 billion nt in human genome ! Part 1. Intro to Genomics

  16. Sequencing Experiment ~$5,000$ in$2001$ ~10¢$ in$2011$ Part 1. Intro to Genomics

  17. Genomics Workflow computational biology / bioinformatics visual analytics data + analysis visualization ! computation ! insight Part 1. Intro to Genomics

  18. Sequencing Experiments De novo assembly ! AGCTTCAGATGGACAGATAA$ GGCATACAGACTTAGACATA$ CCAGACAAGACAGACACAGTA$ TACAAGACATAAGCAATACAGA$ CCAGACAAGACAGACACAGTA$ Genome$Assembly$ Part 1. Intro to Genomics

  19. Sequencing Experiments De novo assembly ! Re-sequencing ! GGCATACAGACTTAGACATA$ AGCTTCAGATGGACAGATAA$ AGCTTCAGATGGACAGATAA$ CCAGACAAGACAGACACAGTA$ GGCATACAGACTTAGACATA$ CCAGACAAGACAGACACAGTA$ CCAGACAAGACAGACACAGTA$ TACAAGACATAAGCAATACAGA$ TACAAGACATAAGCAATACAGA$ CCAGACAAGACAGACACAGTA$ Reference$Genome$ Genome$Assembly$ Part 1. Intro to Genomics

  20. Sequencing Experiments De novo assembly ! Re-sequencing ! Enrichment ! CCAGACAAGACAGACACAGTA$ GGCATACAGACTTAGACATA$ AGCTTCAGATGGACAGATAA$ AGCTTCAGATGGACAGATAA$ AGCTTCAGATGGACAGATAA$ GGCATACAGACTTAGACATA$ CCAGACAAGACAGACACAGTA$ GGCATACAGACTTAGACATA$ CCAGACAAGACAGACACAGTA$ CCAGACAAGACAGACACAGTA$ CCAGACAAGACAGACACAGTA$ TACAAGACATAAGCAATACAGA$ TACAAGACATAAGCAATACAGA$ TACAAGACATAAGCAATACAGA$ CCAGACAAGACAGACACAGTA$ Reference$Genome$ Reference$Genome$ Genome$Assembly$ Part 1. Intro to Genomics

  21. Sequencing Experiments • What sequence variations appear in cancer patients, but not in unaffected individuals? ! • Are these variations predictive of survival outcome? ! • Are these variations causal for the disease (driver mutations) or not? ! ! Part 1. Intro to Genomics

  22. Part 1 - Summary 1. Large and ever increasing volume of sequencing data ! 2. Improved analysis techniques are essential for biologists and clinicians to make the most of these data ! 3. Great potential for visual analytics to facilitate insight and understanding ! ! Part 1. Intro to Genomics

  23. Part 2 Visual Design for Genomics

  24. Challenge 1 Large number of samples for comparison ! Part 2. Visual Design for Genomics

  25. Challenge 1 Large number of samples for comparison ! “To systematically characterize the genomic changes in hundreds of tumors… and thousands of samples over the next five years” ! ! The Cancer Genome Atlas ! www.cancergenome.nih.gov ! Part 2. Visual Design for Genomics

  26. Genome Browsers Stacked data tracks along a common genome x-axis ! Data samples ! Genome coordinate !

  27. Genome Browsers Home Genomes Blat Tables Gene Sorter PCR PDF/PS Session FAQ Help UCSC Cancer Genomics Heatmaps Glioblastoma Copy Number Abnormality, Agilent 244A array (n=200) Data samples ! r e Tumor vs normal d n e G Genome coordinate ! Zhu et al ., Nature Methods, 2009 ! Part 2. Visual Design for Genomics

  28. Challenge 1 Large number of samples for comparison ! ! Critically consider what you need to display ! ! ! ! e.g. replace primary data with a biologically meaningful summary, such as significant changes between samples ! Part 2. Visual Design for Genomics

  29. Challenge 2 Genomic features are small and sparse ! Part 2. Visual Design for Genomics

  30. Genome Browsers LOCAL VIEW ! Part 2. Visual Design for Genomics

  31. Genome Browsers LOCAL VIEW ! Human chr1, 1 pt corresponds to 480 kb, which is larger than 98% of all human genes! ! Part 2. Visual Design for Genomics

  32. Hilbert Curve GLOBAL VIEW ! a b expressed genes Chromosome 3L Cluster of small 5 ′ 3 ′ Open chromatin domain domains PcG 5 ′ 3 ′ Heterochromatin- like domain 5 ′ 3 ′ heterochromatin Pericentromeric 5 ′ 3 ′ Chromatin states: 1 2 3 4 5 6 7 8 9 Kharchenko et al ., Nature, 2011 ! Anders, Bioinformatics, 2009 ! Part 2. Visual Design for Genomics

  33. Challenge 2 Genomic features are small and sparse ! Connect overview and detail ! Part 2. Visual Design for Genomics

  34. Challenge 3 Genomic features involve non-adjacent positions ! Part 2. Visual Design for Genomics

  35. � � Challenge 3 Structural rearrangements ! a b K ʹ J J J ʹ K K ʹ K J ʹ c J K ʹ K J ʹ d J ʹ e Variant K J J ʹ K ʹ J K ʹ K’ K Reference Part 2. Visual Design for Genomics

  36. � � Challenge 3 Structural rearrangements ! a b K ʹ J J J ʹ K K ʹ K J ʹ c J K ʹ K J ʹ d J ʹ e Variant K J J ʹ K ʹ J K ʹ K’ K Reference Part 2. Visual Design for Genomics

  37. Challenge 3 Structural rearrangements ! Circos, Martin Krzywinski ! Part 2. Visual Design for Genomics

  38. � � Challenge 3 Structural rearrangements ! a b K ʹ J J J ʹ K K ʹ K J ʹ c J K ʹ K J ʹ d J ʹ e Variant K J J ʹ K ʹ J K ʹ K’ K Reference Part 2. Visual Design for Genomics

  39. Challenge 3 Structural rearrangements ! VISTA-Dot ! Part 2. Visual Design for Genomics

  40. Challenge 3 All these representations use a genomic coordinate system, which emphasizes base-pair distance between points. ! ! Is this the best use of positional information? ! Part 2. Visual Design for Genomics

  41. Challenge 3 M. Krzywinski adapted from Mackinlay J (1986) ACM Trans Graph 5: 110-141. ! Part 2. Visual Design for Genomics

  42. � � Challenge 3 Structural rearrangements ! a b K ʹ J J J ʹ K K ʹ K J ʹ c J K ʹ K J ʹ d J ʹ e Variant K J J ʹ K ʹ J K ʹ K’ K Reference Part 2. Visual Design for Genomics

  43. Challenge 3 Genomic features involve non-adjacent positions ! Encode important information in position ! Part 2. Visual Design for Genomics

  44. Challenge 4 Large number of data types ! Part 2. Visual Design for Genomics

  45. Genomic rearrangement in cancer A Deletion-type Tail-to-tail inverted SNU-C1 (colorectal): Chr 15 Tandem dup-type Head-to-head inverted Non-inverted orientation 4 Copy 2 number 0 1 Allelic ratio 0 Inverted orientation 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Genomic location (Mb) Stephens et al. , Cell, 2011 ! Part 2. Visual Design for Genomics

  46. 17 mouse genomes N N Z a O O D / / H SNPs S I h L 0 >100,000 D i t L J L SVs C B t P 5 J A 0 742 7 C / / J C B B 2 TEs L 3 A J 1 / B H 0 179 6 / 2 A J / N 9 Uncallable H L CAST/EiJ 1 1 J S B e 2 0 836 2 5 / J 14 9 9 / 13 2 A c 15 1 16 11 S A 18 0 P S J 19 1 7 K v 1 1 / X 2 9 E R J 8 / / 1 7 O S v / J B v 2 6 l r a I d 3 5 m H 4 4 J s d 3 5 6 2 WSB/EiJ 7 1 8 1 9 1 0 2 11 3 12 13 4 14 5 15 16 6 1 7 7 1 8 1 9 8 X 9 10 1 1 1 2 1 2 13 3 14 4 15 5 16 6 17 18 7 19 8 X 9 X 0 1 19 1 1 18 PWK/PhJ 2 1 1 7 13 16 4 15 1 15 1 4 16 13 17 12 18 19 11 10 X 9 8 1 2 7 3 6 4 5 SPRET/EiJ Keane et al ., Nature, 2011 ! b Part 2. Visual Design for Genomics

  47. Challenge 4 Large number of data types ! Exploit domain-specific details in your design ! Part 2. Visual Design for Genomics

  48. Challenge 5 No longer one genome but many ! Part 2. Visual Design for Genomics

  49. Challenge 5 No longer one genome but many ! Part 2. Visual Design for Genomics

  50. Single nucleotide variation Ossowski et al . Genome Research, 2008 ! Part 2. Visual Design for Genomics

  51. Single nucleotide variation Integrative Genomics Viewer (IGV) ! Robinson et al . Nature Biotechnology, 2011 ! Part 2. Visual Design for Genomics

  52. Challenge 5 No longer one genome but many ! Be open to change (genomics is evolving quickly) ! Part 2. Visual Design for Genomics

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend


More recommend