Metagenomic analysis of spoiled potato and tomato and the use of the - - PowerPoint PPT Presentation
Metagenomic analysis of spoiled potato and tomato and the use of the - - PowerPoint PPT Presentation
Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa, Science Campus, Florida, 1710, South
Unisa Science Campus
Research
- Metagenomics
- Plant-microbe interactions
- Potato diseases
Metagenomics: Introduction
- Metagenome – Handelsman 1988
– University of Wisconsin–Madison
- As applicable to bacteria
- Popular – gut, soil, extreme environments, ocean water, sewage
- Direct study of genetic material from environmental samples
- Prominence with high-throughput genomic sequencing
Known metagenomics projects
- Sargasso Sea and Global Ocean Survey
Metagenomics
– genetic diversity in marine microbial communities
- Human Microbiome Project
Rationale for our study
Introduction: Bacterial metagenomics of potato and tomato
Laphalale Polokwane Hoedspruit Skeerpoort Ladanna Warden Bothaville Petrusburg Vryburg
Metagenomics: Sample preparation
PCR products of the 16S rRNA gene run through agarose gel
pAF:AGAGTTTGATCCTGGCTCAG/ pHR:AAGGAGGTGATCCAGCCGCA Edwards et al., 1989
Analysis of the 16S rRNA gene
pAF:AGAGTTTGATCCTGGCTCAG/pHR:AAGGAGGTGATCCAGCCGCA Edwards et al.,
amplified ~ 550 bp of the 16S region targeting the v3-v4 region with Illumina MiSeq 300 x 300 pair-end reads
MALDI-TOF
MALDI-TOF compared with sequence analysis of the 16S rRNA gene
Sample code Source Locality Identification by MALDI-TOF Identification by sequence analysis of the 16S rRNA gene GeneBank Accession number Comment on mismatch identification
Unisa1a
Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823022 Unisa2a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823024 Unisa3a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823030 Unisa4a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823036 Unisa5b Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823029
Results of the 16S rRNA gene-based metagenomics
Organism/Hit name Cluster size Result count Comment Acinetobacter sp. 1 1 Acricotopus lucens 1 1 Non bacterial hit Alicyclobacillus acidoterrestris 1 1 Non bacterial hit Allenhyphes flinti 1 1 Spoilage bacterium Anaplasma platys 1 1 Canine pathogen Antheraea pernyi 1 1 Non bacterial hit Aphidius ervi 1 1 Non bacterial hit Asterias forbesii 1 1 Non bacterial hit Bacillus halodurans 18 1 Bacillus licheniformis 11 2 Bacillus sp. 9 3 Bacillus subtilis 3336 4 Clastoptera testacea 1 1 Non bacterial hit Danaus affinis 1 1 Non bacterial hit Geobacillus thermoleovorans 279 2 Enterobacter sp. 7377 5 Eucalyptus tereticornis 1 1 Non bacterial hit Fusarium equiseti 1 1 Non bacterial hit Fusarium oxysporum 1 1 Non bacterial hit Galleria mellonella 4 3 Non bacterial hit Geobacillus sp. 69 3 Geobacillus stearothermophilus 566 2 Myroides sp. 3 1 Nicotiana tabacum 18 3 Non bacterial hit
Results of the 16S rRNA gene-based metagenomics: Summary Dominant genera
- Bacillus
- Geobacillus
- Enterobacter
Bacillus and plants
- Growth promoter
- Control of pathogens
- Effect on germination and on potato growth
scanty
- Bacillus – an antagonist of the blackleg
pathogen Pbcb
- New tools, and a variety of combined
treatments
Bacillus and plants
Seed germination AND seedling vigour experiment
- Okra
- Seed coated with Bacillus subtilis
- 5 x 3 x 2 factorial experiment (rep 5x in 3 cycles)
– Aluminium toxicity, temperature and B & No B – In total 450 Petri plates were examined in the data collection, 50 plates for the chemical analysis
Seed germination assays
Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed Secondary metabolite shifts in the germinated seed
Cations quantified in the 50 samples
K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) 8467.400 5703.200 3414.280 1425.776 769.064 3143.028 70.020 60.210 18.560 21.134 11.455 Avearage (No Bacillus) 8196.120 5628.800 3355.040 1437.152 604.252 3308.372 65.164 59.859 18.580 20.960 11.247
Anions quantified in the 50 samples
PO4
3- mg/kg
Fl- mg/kg Cl- mg/kg SO4
2- mg/kg
NO3
- mg/kg
NO2
- mg/kg
Avearage (Bacillus) 3358.940 968.550 2166.400 643.780 131.400 40.360 Avearage (No Bacillus) 4172.370 606.200 2106.870 629.290 169.830 16.600
Seed germination assays
Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed
Cations quantified in the 50 samples
K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) 8467.400 5703.200 3414.280 1425.776 769.064 3143.028 70.020 60.210 18.560 21.134 11.455 Avearage (No Bacillus) 8196.120 5628.800 3355.040 1437.152 604.252 3308.372 65.164 59.859 18.580 20.960 11.247
Anions quantified in the 50 samples
PO4
3- mg/kg
Fl- mg/kg Cl- mg/kg SO4
2- mg/kg
NO3
- mg/kg
NO2
- mg/kg
Avearage (Bacillus) 3358.940 968.550 2166.400 643.780 131.400 40.360 Avearage (No Bacillus) 4172.370 606.200 2106.870 629.290 169.830 16.600
No differences in the ionic composition of Bacillus-treated and Bacillus-untreated samples: conclusion
Effect of Bacillus on the germination on okra
Effect of Bacillus on the germination on okra
Secondary metabolite shifts due to Bacillus treatment
Secondary metabolite shifts due to Bacillus treatment
Data output was NMR intensity values Phase correction and baseline correction of the NMR spectra were done using ACD/NMR Processor. NMR intensities were selected from the range zero to 14 ppm. PCA was done using Multibase 2014
Bacillus and plants Potato growth, yield and disease suppression studies
Data collected in the plant growth studies
- Growth parameters
- Stomatal conductance
- Chlorophyll content
- Chemical analysis
- Will extend to a whole range of molecular data
Effect of Bacillus on the growth of potato
Effect of Bacillus on the growth of potato
Preliminary findings
- A few bacterial species dominate potato and tomato
- Sequence analysis of the 16S rRNA gene and MALDI-TOF
give the same result of bacterial species IDs
- Bacillus – one of the dominant species promotes germination
- f okra growth of potato
- Not much bacterial cells are needed to cause germination and
growth effects
- Bacillus ineffective in high temperature
- A small portion of the okra germinating seed chemistry is
altered to boost germination
Still to come
- Tuber yield data
- Bacterial antagonism
- Molecular interactions between Bacillus and
bacterial plant pathogens
Acknowledgements
- Postdoctoral researcher – Sheku Kanu
- MSc student – Taboga Mathiba
- BTech students –Livhuwani Nemutandani and Mpho
Nematswerani
- PPRI for providing the Bacillus strains used
- Inqaba Biotech and the ARC Biotechnology Platform for their
facilities and expertise shared
- University of Pretoria for MALDI-TOF
- Unisa for funding