AREVIR Meeting 2010
- J. Snoeck – April 22th
Genotyping near full-length hepatitis C viruses Snoeck Joke Rega - - PowerPoint PPT Presentation
Genotyping near full-length hepatitis C viruses Snoeck Joke Rega Institute for Medical Research, KU Leuven, Leuven, Belgium AREVIR Meeting 2010 J. Snoeck April 22th Introduction AREVIR Meeting 2010 J. Snoeck April 22th Hepatitis C
AREVIR Meeting 2010
AREVIR Meeting 2010
AREVIR Meeting 2010
Anzola et al., Expert Reviews in Molecular Medicine, 2003
AREVIR Meeting 2010
uncoating
processing
Moradpour et al., Nature Reviews 2007
AREVIR Meeting 2010
host factor inhibitors, immunomodulators, …..
Moradpour et al., Nature Reviews 2007
AREVIR Meeting 2010
subtypes
Irshad, Reviews in Medical Virology, 2008
Selective pressure
AREVIR Meeting 2010
>NS5B CTAaACCTCaaAGAAaAACCAAACGTAATACCAACCGCCGCCCACAGGACGTTAAGTTCCCGGGCGGCGGCCAGATCGT TGGTGGAGTTTACTTGTTGCCGCGCAGGGGCCCCAGGTTGGGTGTGCGCGCGACTAGGAAGACTTCCGAGCGGTCGC AACCTCGTGGAAGGCGACAACCTATCCCCAAGGCTCGCCGGCCCGAGGGCAGGACCTGGGCTCAGCCCGGGTACCCT TGGCCCCTCTATGGCAACGAGGGCATGGGGTGGGCAGGATGGCTCCTGTCACCCCGCGGCTCCCGGCCTAATTGGGG CCCCACAGACCCCCGGCGTAGGTCGCGTAACTTGGGTAAGGTCATCGATACCCTCACATGCGGCTTCGCCGATCTCAT GGGGTACGTTCCGCTCGTCGGTGCCCCCCTAGGGGGCGTTGCCAGGGCCCTGGCGCATGGCGTCCGGACTCTGGAG GACGGCGTGAACTATGCAACAGGGAACTTGCCCGGTTGCTCTTTCTCTATCTTCCTCTTGGCTTTGCTGTCCTGTTTGAC CATCCCAGCTTCCGCTTATGAAGTGCGCAACGTGTCCGGGGTGTACCATGTCACGAACGACTGCTCCAACTCAAGCATT GTGTATGAGGCAGCGGACATGATCATGCACACCCCCGGGTGCGTGCCCTGCGTTCGGGAAGCCAACTCCTCCCGCTG CTGGGTAGCGCTCACCCCTACGCTTGCGGCCAGGAACGCTAGTGTCCCCACCGTGACAATACGACGCCATGTCGATTT
AREVIR Meeting 2010
AREVIR Meeting 2010
AREVIR Meeting 2010
5’UTR-NS2 inner PCR E2-NS5A inner PCR NS4B-NS5B inner PCR 5’UTR-NS2 outer PCR E2-NS5A outer PCR NS4B-NS5B outer PCR cDNA synthesis from 3’UTR cDNA synthesis from NS5A cDNA synthesis from NS2
AREVIR Meeting 2010
AREVIR Meeting 2010
Partial PCR HCV1a HCV1b 1st (5'UTR-NS2) 935 (170-1700) 1700 (170-1700) 2nd (E2-NS5A) 1700 (170-17000) 1700 (1700-17000) 3rd (NS4B-NS5B) 1700 (170-170000) 17000 (1700-170000)
Mean detection limit based on a dilution series of 10 samples Reproducibility based 50 (1a) or 35 (1b) samples tested in triplicate
# postitive PCRs3 1st (5'UTR-NS2) 2nd (E2-NS5A) 3rd (NS4B-NS5B) 1st (5'UTR-NS2) 2nd (E2-NS5A) 3rd (NS4B-NS5B) 0 positive
0 (0%) 0 (0%) 2 (6%) 0 (0%) 2 (4%) 2 (4%)
1 positive
0 (0%) 1 (3%) 2 (6%) 2 (4%) 5 (10%) 7 (14%)
2 positive
1 (3%) 1 (3%) 3 (8%) 17 (34%) 23 (46%) 17 (34%)
3 positive
34 (97%) 33 (94%) 28 (80%) 31 (62%) 20 (40%) 24 (48%)
HCV1a1 HCV1b2
Performance of the sequencing primers :
AREVIR Meeting 2010
G e n
y p e 1 c Genotype 4 G e n
y p e 5 G e n
y p e 6 G e n
y p e 3 G e n
y p e 2 0.05
AREVIR Meeting 2010
– Study appearance of drug resistance-related variants under drug selective pressure – Study evolution of the virus under drug/immune/… selective pressure – Study epidemiology of the virus – Study the mode of action of new anti-HCV drugs – …
– Study the mode of action of new anti-HCV drugs – Study mutations in different genes at the same time – …
AREVIR Meeting 2010
AREVIR Meeting 2010
– On first sight : YES – Upon closer examination : not necessarily
Protease Active site: binding site for inhibitor and natural substrate Inhibitor cannot bind resistant protease Substrate can still bind reduced function
AREVIR Meeting 2010
Fukuhara et al., Journal of Hepatology 2010 Yi et al., Virus Research 2009 Taylor et al., Science 1999
AREVIR Meeting 2010
Moradpour et al., Nature Reviews 2007 Sarazin and Zeuzem, Gastroenterology 2010
AREVIR Meeting 2010
Sarazin and Zeuzem, Gastroenterology 2010 Moriishi et al., Reviews in Medical Virology 2007
AREVIR Meeting 2010
In vitro resistance-related mutations
Puyang et al., Antimicrobial Agents and chemotherapy 2010
AREVIR Meeting 2010
– about 100 euro material to amplify the 3 parts of the genome – on average (depending on the genotype) 40 sequencing primers, 5 euro per reaction = 200 euro for sequencing (by a commercial company) 300 euro per patient sample without the personnel cost
– Amplifying the genome does not take that much time, but the analysis of the sequencing results is quite labour-intensive !
AREVIR Meeting 2010
AREVIR Meeting 2010
1a and 1b, based on PCR amplification and capillary sequencing.
NS2-NS5A region, 1700 viral copies/ml or lower. The detection limit for the NS4B-3’UTR region for both assays was less. Such a sensitivity is sufficient to investigate the in vivo mode of action of new anti- HCV drugs, and the method can be used to monitor HCV therapy response.
sequence the near-full length genome of HCV1a and 1b strains in both directions. This enables us to reliably detect quasispecies and use the assay for determining genotypic drug resistance in patient strains.
AREVIR Meeting 2010
– Polymerase inhibitors NS5B – Protease inhibitors NS3
AREVIR Meeting 2010
– Go deeper than 25% detection of quasispecies – Easier analysis of sequencing data if there is adequate software available – Faster : pool samples using barcoding
AREVIR Meeting 2010
Rega Institute for Medical Research