An-jie Li School of Environment Beijing Normal University 15 - - PowerPoint PPT Presentation

An-jie Li

School of Environment Beijing Normal University

15 September 2016

2

Great energy demand Energy crisis Greenhouse gas emission Global warming Air pollution

Introduction

Increasing interest in renewable energy

3

Biodiesel is a petroleum diesel substitute produced by transesterification of lipid feedstock that yields the methyl esters of the fatty acids (FAMEs) .

(Knothe, 2005)

Introduction

High cetane number and flash point Low air pollutants emission Nontoxic Completely degradable Excellent lubricity

Biodiesel

Plant oils Animal fats Microbial lipid The high cost of lipid feedstock has restricted the commercialization of biodiesel production (>70% of the overall production cost) (Zhao and Hu, 2011).

Introduction

4

5

Introduction Low cost Sustainable supply Low lipid content

• 1. Increasing the organic loading (Mondala et al., 2012)
• 2. Increasing C/N (Mondala et al., 2012)
• 3. Utilizing different carbon sources (Mondala et

al.,2013, 2015)

Promote lipid accumulation

small-scale wastewater system

Introduction

6

Granules Bioflocs

Activated sludge Aerobic granule Size (mm) <0.5 0.2-5 SVI (ml/g) 70-150 20-80 Settling velocity (m/h) 5.8-17.6 30-70 Specific gravity 1.002 1.004- 1.064 Integrity coefficient (%)

• > 95

Using granular sludge(GS) to treat sugar-containing wastewater with high organic concentration and to produce biodiesel.

AGS Biodiesel Wastewater

Reutilization

7

Operation parameters Microbial structure Granular sludge

• 1. synthetic sugar-containing wastewater treatment
• 2. biodiesel production

seed sludge concentration, HRT and sludge loading rate lipid accumulation of granular sludge the relationships among operation conditions, characteristics of sludge and biodiesel production

8

Materials and methods

Phase Reactor Initial MLSS (g/L） HRT （h） Settling time (min) Sludge discharge （mL/d） Start-up 1 2.8 8 30 2 2.8 8 30→2 I 1 8 12 2 2 5.3 12 3 4 12 II 1 8 2 2 8 3 8 III 1 8 2 100 150 2 8 3 8

H=80 cm, D=5 cm, V=1.2L Air flow velocity: 1.0 L/min COD: 2000mg/L COD:N:P=100:2:1 Granular sludge

microbial structure

MLSS SVI Glucose, NH4-N+

FAMEs yield (mg/g SS) FAMEs yield (g/L wet sludge) FAMEs distribution

9

Materials and methods

5000r/min, 5min 2g dewatered GS 30mL 5% H2SO4-CH3OH 10mL hexane 75℃，7h Centrifugation Transesterification

FAMEs extraction GC-FID analysis

Centrifugation 3000r/min, 3min

10

Materials and methods

High-throughput sequencing on Illumina MiSeq PE300 platform Real-time Quantitative PCR Microbial population structure Distribution of bacteria and fungi 16s 18S

Eub338 (ACTCCTACGGGAGGCAGCAG)

18S-F (CGGCTACCACATCCAAGGAA)

Eub518 (ATTACCGCGGCTGCTGG)

18S-R (GCTGGAATTACCGCGGCT)

Primers

11

Results and discussion

Cultured activated sludge (CAS) Cultured granular sludge (CGS)

12

• CGS showed an advantage in biodiesel production both in yield and in quality compared with CAS.
• The possible reason is the difference in the microbial community, including the growth of fungi

(Phialophora) and a change in the bacterial population.

Results and discussion

2 4 6 8

Volumetric loading rate (kgCOD/(m3.d)) R1 R2 R3 (a)

I II III 0.00 0.20 0.40 0.60 0.80 1.00 1.20 7 14 21 28 35 42 49 56 63 70 77

Sludge loading rate (kg COD/(kg MLSS·d)) Days (c)

I II III 0.00 6.00 12.00 18.00 24.00 30.00 36.00

MLSS(g/L)

I II III

(b)

0.00 30.00 60.00 90.00 120.00 150.00 7 14 21 28 35 42 49 56 63 70 77

SVI(mL/g) Days

(d) I II III

• The difference of initial sludge loading rate led to the different morphological features of the granules.
• A higher sludge loading rate brought about overgrowth of white filamentous microorganism in the

granular sludge.

13

20 30 40 50 60 70 80 90 100

7 14 21 28 35 42 49 56 63 70 77 FAMEs (mg/g SS) Days GS1 GS2 GS3

I II III (a)

1 2 3 4 5 6

7 14 21 28 35 42 49 56 63 70 77 FAMEs (g/L wet sludge) Days

I II III (b)

Results and discussion

𝐆𝐁𝐍𝐅𝐭( 𝒏𝒉 𝒉 𝑻𝑻) = 𝑮𝑩𝑵𝑭𝒋 𝑼𝒊𝒇 𝒙𝒇𝒋𝒉𝒊𝒖 𝒑𝒈 𝒆𝒔𝒛 𝒕𝒎𝒗𝒆𝒉𝒇 𝐆𝐁𝐍𝐅𝐭( 𝒉 𝑴 𝒙𝒇𝒖 𝒕𝒎𝒗𝒆𝒉𝒇) = 𝑮𝑩𝑵𝑭𝒕( 𝒏𝒉 𝒉 𝑻𝑻) 𝑻𝑾𝑱( 𝒏𝑴 𝒉 𝑻𝑻)

• Sludge loading rate might be more important than volumetric loading rate for the promotion of biodiesel

production from sewage sludge.

• R3 with much filamentous fungi led to the highest FAMEs yield based on the dry weight, but R2

performed better on the volumetric FAMEs productivity.

Bacteria(%) Fungi (%)

R1 67 33 R2 64 36 R3 41 59 Results and discussion

G+

Dipodascaceae

bacteria at genus level

70-day running

• Different initial sludge loading rate led to the distinctive microbial structure of granular sludge in the

three reactors.

• The difference on the ratio of bacteria to fungi and bacterial population of granular sludge resulted in

the different FAMEs yield and distribution.

15



Compared with activated sludge, the granular sludge showed an advantage in biodiesel production both in yield and in quality.



Lower seed biomass and higher initial sludge loading rate resulted in the dominance of filamentous fungi in granular sludge, which contributed to the improvement of FAMEs yield.



The overgrowth of filamentous fungi would deteriorate the settling and compression ability of granular sludge, which do harm to the stability of granular sludge system and biodiesel production.



Controlling the filamentous fungi at a moderate level through the effective operating strategy is of great importance to actual application of biodiesel production from granular sludge system feeding with sugar-containing wastewater.

16

 National Natural Science Foundation of China (No. 51478042 )  Ms Li Mei-xi  Mr Sun Qu

THANK YOU

E-mail: liaj@bnu.edu.cn